Collection and processing of specimens
Beginning in the fall of 2020, all employees and students on the Rockefeller University campus (approximately 1,400 people) were tested at least weekly with a saliva-based PCR test developed in Darnell Clinical Laboratory Improvement Laboratories – Laboratory Evaluation Program clinical laboratory (approval number), PFI-9216) and approved for clinical use by a New York State Emergency Use Authorization. The saliva sampling protocols for the clinical testing of SARS-CoV-2 were reviewed by the Institutional Review Board at Rockefeller University and were considered not to be research involving human subjects. The Institutional Review Board approved the written consent for the analysis of antibody titers from patient 1, and the study was conducted in accordance with the guidelines of the International Council for the Harmonization of Good Clinical Practice.
In accordance with New York State eligibility regulations, 417 employees who received a second dose of either BNT162b2 vaccine (Pfizer – BioNTech) or mRNA-1273 (Modern) at least 2 weeks previously were tested between January 21 and March 2021, and weekly testing continued thereafter. The demographic characteristics of these 417 persons and of the 1491 unvaccinated persons tested in parallel at Rockefeller University in the same period are presented in Table S1 of the Supplementary Annex, available together with the full text of this article at NEJM.org.
Employees and students were instructed to provide a saliva sample in a cup of medication and transfer 300 μl to a vial containing 300 μl of Darnell Rockefeller University Laboratory (DRUL) buffer (5 M guanidine thiocyanate, 0.5 % sarcosyl and 300 mM sodium acetate [pH 5.5]).2 Samples were processed on the Thermo KingFisher Apex system for rapid RNA purification, and complementary DNA (cDNA) was amplified using TaqPath 1-Step RT-qPCR (Reverse Quantitative PCR Transcriptase) Master Mix (Thermo Fisher Scientific) and multiplexed primers and probes that were validated under a Food and Drug Administration Emergency Use Authorization (Table S2) with the 7500 Fast Dx Real-Time PCR Detection System (Applied Biosystems). The samples were considered interpretable if the threshold of the household control cycle (RNase P) (Ct) was less than 40, and the viral RNA was considered detected with both viral primers and probes (N1 and N2, detecting two regions of the nucleocapsid [N] SARS-CoV-2 gene) at a Ct less than 40.
Viral load calculation
We calculated the viral load per milliliter of saliva using chemically inactivated SARS-CoV-2 (ZeptoMetrix) with peak in saliva at different dilutions. Extractions and RT-PCR were performed as previously described to determine the appropriate Ct values for each dilution (Fig. S1).
Targeted sequencing
Reverse transcription of RNA samples was performed with the iScript (Bio-Rad) mixture according to the manufacturer’s instructions. PCR amplification of cDNA was performed using two sets of primer (primer 1: direct primer 1 [CCAGATGATTTTACAGGCTGC] and reverse primer 1 [CTACTGATGTCTTGGTCATAGAC]; primer set 2: primer 2 before [CTTGTTTTATTGCCACTAGTC] and reverse primer 1). The PCR products were then extracted from the gel and sent to Genewiz for Sanger sequencing.
Neutralization test
Neutralization tests with human immunodeficiency virus type 1 replication pseudotype modified with SARS-CoV-2 spike protein were performed as previously described.3 Mean titers of serum neutralizing antibodies (50% neutralization test [NT50]) were calculated as an average of three independent experiments, each performed using technical duplicates, and the statistical significance was determined with the Mann-Whitney two-tailed test.
Sequencing of the entire viral RNA genome
The total RNA was extracted as described above and a meta-transcriptomic library was constructed for pair sequencing (150 bp readings) with an Illumina MiSeq platform. The libraries were prepared with the SureSelect XT HS2 DNA System (Agilent Technologies) and the Pan Human Design Coronavirus Panel (Agilent Technologies) according to the manufacturer’s instructions. FASTQ files (a text-based format for storing both a biological sequence and corresponding quality scores) were cut with Agilent Genomics NextGen Toolkit (AGeNT) software (version 2.0.5) and used for downstream analysis . The SARS-CoV-2 genome was assembled with MEGAHIT with the default parameters, and the longest sequence (30,005 nucleotides) was analyzed with the Nextclade software (https://clades.nextstrain.org/) to assign clade mutations. and calls. The detected mutations were confirmed by aligning the RNA sequential readings on the SARS-CoV-2 reference genome sequence (GenBank number, NC_045512) with the Burrows-Wheeler Aligner (BWA-MEM).
Patient stories
Patient 1 was a 51-year-old healthy woman with no risk factors for severe Covid-19 who received the first dose of mRNA-1273 vaccine on January 21, 2021 and the second dose on February 19. He strictly observed the routine of precautions. Ten hours after receiving the second dose of vaccine, muscle pain developed. These symptoms disappeared the next day. On March 10 (19 days after receiving the second dose of vaccine), he developed a sore throat, congestion and headache and tested positive for SARS-CoV-2 RNA at Rockefeller University later that day. On March 11, he lost his sense of smell. Her symptoms gradually resolved over a period of 1 week.
Patient 2 was a healthy 65-year-old woman with no risk factors for severe Covid-19 who received the first dose of BNT162b2 vaccine on January 19 and the second dose on February 9. The pain developed in the inoculated arm lasted 2 days. On March 3, her unvaccinated partner tested positive for SARS-CoV-2, and on March 16, fatigue, sinus congestion, and a headache developed in patient 2. On March 17, she felt worse and tested positive for SARS-CoV-2 RNA 36 days after completion of vaccination. Her symptoms flattened and began to resolve on March 20.